Powtarzająca się dominująca negatywna mutacja E47 powoduje agammaglobulinemię i BCR Komórki B. ad 6

Pozwala to na zwiększone wiązanie DNA z niektórymi członkami rodziny bHLH, takimi jak MyoD, które źle homodimeryzują i nie mogą wiązać samego DNA (13). Mutant E475K E55 będzie także wiązał się z członami rodziny Id i z nich sekwestrem, grupą czynników transkrypcyjnych HLH, które nie posiadają domeny wiążącej DNA i dlatego hamują wiązanie DNA przez członków rodziny E (22). Jest również możliwe, że zmutowany E555K E47 wiąże się z sekwencjami docelowymi DNA, które różnią się od sekwencji konsensusowej kanonicznego białka E. Może to skutkować zwiększoną lub zmniejszoną produkcją białek, które zwykle nie są kontrolowane przez E47. Komórki B pozbawione BCR u pacjentów z mutacją E555K sugerują, że istnieje próg dla funkcji E47. Niewielka ilość E47 pozwala na pewien postęp rozwojowy komórek linii B, ale potrzeba więcej E47, aby wymusić blok w różnicowaniu komórek, które nie mają funkcjonalnego pre-BCR. Jest to podobne do wpływu zmniejszonej lub nieobecnej funkcji E2A w rozwoju limfocytów T. Szmata./. myszy, które mają zmniejszone lub nieobecne E2A, rozwijają się niektóre komórki CD4 + CD8 +, komórki, które zwykle nie występują u myszy z niedoborem Rag, ponieważ ten etap rozwoju wymaga funkcjonalnego pre-TCR (23, 24). Jednak komórki te nie dojrzewają dalej i nie opuszczają grasicy. Komórki B pozbawione BCR nie były uprzednio opisane u ludzi, a obecność tych komórek u pacjentów z mutacją E555K wskazuje, że przejście pro-B do przejścia komórek pre-B jest kontrolowane nie tylko przez sygnalizację przez pre- BCR, ale także mechanizmy kontroli jakości zapobiegające dalszemu rozwojowi komórek pozbawionych pre-BCR. Nasze badania pokazują, że E47 odgrywa kluczową rolę w tej kontroli jakości. Metody Sekwencjonowanie całego egzonu przeprowadzono jak opisano wcześniej (25), z dodatkowymi szczegółami w metodzie dodatkowej. Sekwencjonowanie Sanger zastosowano do sprawdzenia mutacji w BCR. pacjenci. Wektory ekspresyjne wytworzono przez klonowanie cDNA E47 do wektora ekspresyjnego sterowanego CMV. Mutagenezę ukierunkowaną stosowano do wytworzenia zmutowanego cDNA. Sondy dla EMSA pochodziły z regionów regulatorowych mysiego wzmacniacza łańcucha ciężkiego immunoglobuliny ((E5 GATCCCAGAACACCTGCAGCAG) i mysiej kinazy kreatyninowej (GTCACCCCCCAACACCTGCTGCCTA). Statystyka. Wykresy słupkowe pokazane na rysunkach 2 i 3 wskazują średnią. SEM z 3-5 eksperymentów. Zatwierdzenie badania. Badania te zostały przeprowadzone w ramach protokołu badawczego zatwierdzonego przez szpital badawczy St. Jude Children s IRB w celu identyfikacji i scharakteryzowania wad genetycznych układu odpornościowego. Pisemną świadomą zgodę uzyskano od wszystkich pacjentów lub ich rodziców. Pełne metody są dostępne w dodatkowych metodach. Materiały uzupełniające Zobacz dane uzupełniające Podziękowania Dziękujemy pacjentom i ich rodzinom za udział w badaniach, Vanessie Howard za pomoc w opiece nad pacjentami, Keithowi Pierce owi za pomoc techniczną oraz Frank Saulsbury, Seema Aceves, Gayle Tyerman i Davidowi Fulcherowi do dostarczania materiałów dla pacjentów Fundusze zostały przekazane przez Le Bonheur Research Funds, środki z Katedry Doskonałości Federal Express, National Cancer Institute dotacji P30 CA21765 (NIH), libańskich stowarzyszonych organizacji charytatywnych z Syrii, dotacji i stypendiów badawczych z National Health and Medical Research Council of Australia, St. Giles Foundation, Narodowe Centrum Zasobów Badawczych, Narodowe Centrum Zaawansowanych Nauk (NCATS, grant nr 8UL1TR000043 od NIH) oraz Uniwersytet Rockefellera. Przypisy Konflikt interesów: Autorzy zadeklarowali brak konfliktu interesów. Informacje referencyjne: J Clin Invest. 2013; 123 (11): 4781. 4785. doi: 10,1172 / JCI71927.
[więcej w: dna moczanowa leczenie ziołami, narodowy fundusz zdrowia skierowania, olej z konopii indyjskiej opinie ]
[patrz też: chlorowodorek pseudoefedryny, jedzenie niskokaloryczne, leki przeciwhistaminowe iii generacji ]